logo
Volume 11, Issue 1 (2022)                   J Police Med 2022, 11(1) | Back to browse issues page


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

jalili S, shirzad H, salehi S, taghizadeh P, mohammadi R. Evolutionary evaluation of the dominant genetic haplotype of SARS-CoV-2 virus in Iran from June to November 2020. J Police Med 2022; 11 (1)
URL: http://jpmed.ir/article-1-1064-en.html
1- Research Center for Life & Health Sciences & Biotechnology of the Police, Directorate of Health, Rescue & Treatment, Police Headquarter, Tehran, Iran , Jalili.shirin@yahoo.com
2- Research Center for Life & Health Sciences & Biotechnology of the Police, Directorate of Health, Rescue & Treatment, Police Headquarter, Tehran, Iran
3- Master of Genetics, Research Center for Life & Health Sciences & Biotechnology of the Police, Directorate of Health, Rescue & Treatment, Police Headquarter, Tehran, Iran
4- PhD in Military Psychology, Research Center for Cognitive & Behavioral Sciences in Police, Directorate of Health, Rescue & Treatment, Police Headquarter, Tehran, Iran
English Extended Abstract:   (2475 Views)
Introduction
... [1-13]. Preliminary studies identified 66 haplotypes and subhaplotypes on SARS-CoV-2 virus genomic sequences in 13 H1-H13 haplotype groups [14, 15]. These groups have been identified and defined as the most common genotyped haplotypes in viruses spread in the early stages of the COVID-19 pandemic [14, 15]. ... [16-18]. According to the data obtained from the studies of Dr. Elahi et al. On many sequences registered from other countries in the GISAID database, it has been found that three haplotypes (H5, H2, H1) among these haplotypes show the highest frequency compared to the others in the early stages of the COVID-19 epidemic [14].
Aim (s)
This study aimed to evaluate the evolution of the dominant genetic haplotypes of the SARS-CoV-2 virus in Iran from June to November 2020.
Research Society, Place and Time
Viral RNA samples from this cross-sectional study, whose COVID-19 infection was confirmed by PCR test, were collected from individuals who were referred to one of the police force diagnostic laboratories in Tehran, Iran from June to November 2020.
Sampling Method and Number
The sample size was estimated to be 300 people. Sampling was performed completely randomly, regardless of age, sex, or severity of the disease in infected individuals. In selecting the samples, it was also tried not to select people with a relative ratio who were likely to be infected with a type of virus. The samples were included in the study in such a way that first the PCR test of the subjects should be positive and also the (Cycle threshold) CT of these samples should be between 14 and 24.
Used Devices & Materials
As a pattern, RNA samples were used to perform cDNA synthesis reactions using Mastermix cDNA synthesis (BIO FACT, Korea; Cat no: BR441-096). In these reactions, all three reverse PCR primers related to each of the three mutations were used. After cDNA synthesis from RNA samples, the ARMS-PCR technique was used to determine the genotype of nucleotides located in genomic positions T<14408C in haplotype H1 and T<8782C in haplotype H2 and mutation C<28688 in haplotype H5. For the ARMS-PCR response for mutations of T<14408C, T<8782C, and C<28688T, six primer pairs were designed using Gene runner v6.5.52Beta software to amplify the target genomic regions in such a way that the amplified fragment was amplified in the region. No mutation occurs only in the presence of the unchanged sequence-specific primer, and amplification of the fragment of the mutant region occurs only in the presence of the mutant-specific primer (Table 1). Therefore, for each synthesized cDNA sample, two series of PCR reactions were performed using MasterMix PCR (amplicon; 180301-50 2X Master Mix Red-Mgcl2: 15mM) and primers related to each change. The first reaction was with primers related to the non-mutated region and the second reaction was performed with the primers related to the mutated region. In haplotype H1, the length of the amplified fragment corresponding to the mutated region was 216 bp and the length of the amplified fragment related to the non-mutated region was 470 bp. Therefore, in electrophoresis of PCR products, mutated and non-mutated samples were observed on agarose gel with 216 and 470 bp bands, respectively. Also, in the studied change, in the H2 haplotype, a band with a fragment mutation of 240 bp is synthesized and in the normal sample, no fragment mutation with a length of 462 bp is synthesized. In the H5 haplotype, the amplitude of the amplified fragment for mutated and non-mutated regions was 214 and 493 bp, respectively. As a result, 214 bp and 493 bp bands were observed by electrophoresis of PCR products on an agarose gel. Then, to verify the results of genotyping the target genomic loci, the genomic fragments of 20 samples were sequenced by the Sanger sequencing method. Sequences were analyzed using Sequencher.V5.4.6 software. The Wuhan-Hu-1 isolated genome sequence (NC_045512.2) was also used as the SARS-CoV-2 reference sequence using the NCBI database.
Ethical Permissions
This plan was approved by the Research Council of the Deputy of Health of the police force in 2020 with the code 990706/03/33 and all ethical considerations were observed.
Finding by Text
A total of 291 valid RNA samples were collected from 300 cases of genomic material extracted from patients, and the dispersion of the samples received during different months was recorded (Table 2). The age of the subjects was reported to be between 17 and 66 years, which included both males and females. After cDNA synthesis and ARMS-PCR reactions and electrophoresis of the obtained products, it was observed that a total of 122 samples with C
Sanger sequencing also confirmed these results (Figures 1 and 2 c). The frequency of carriers was also compared by sample collection months. In the first months of the study period (June), the H5 haplotype group was the first group to be observed in the Iranian patient population after the COVID-19 epidemic, but gradually due to H1 haplotype prevailed due to the dynamics of the virus genome and new changes in the genome; So that in the last months of the selected period (November), in our samples, haplotype H1 reached a frequency of nearly 100% (Figure 3). While examining the samples in the period of six months, respectively, from June to November, 11 samples (0-1-3-2-3-2) with two nucleotides were observed in one place, which means that the person infected with two viruses has genetic haplotypes. Was infected differently. At the beginning of the study period, when only the H5 haplotype was the dominant haplotype, no specimens with two different nucleotides were observed at the same site, but over time, both H1 and H5 viral haplotypes were observed in the population. 11 infected samples were observed that were infected with both H1 and H5 viral haplotypes (Figures 1 and 2b). H2 haplotype was also the first group to appear in a very short time in the early days of the COVID-19 epidemic in East Asia, including China. The study also tested this haplotype group, which was not found in any of the sequences, and as a result, it was predicted that the H2 haplotype group was most likely removed from the viral population. Therefore, no haplotype of H2 was observed in this project. The results of this study also showed that all 291 samples that were PCRed were in two groups of haplotypes H1 and H5.
Main Comparison to the Similar Studies
The first virus sequence from Iran was uploaded on April 4 in GISAID (EPI_ISL_424349). In the same study, Eden et al. observed three major mutations in G1397A, T28688C, and G29742T in the genomes of patients with a history of travel to Iran, representing a distinct haplotype group of specific viral variants present in Iran at the time [19] and indicating the first. The sequence is available to the Iranian population with the H5 strain. As of October 23, 2020, there were only eight complete genomes in GISAID that were not sufficient to detect the virus in the country, and in the only epidemiological study of the outbreak in Iran, they used a genomic sequence specified from travelers to Iran. After some time, Najmabadi et al. In their study performed 50 samples of the virus genome in Iran incomplete genomic sequencing. The results of Najmabadi et al.'s research show that the primary viruses infecting the Iranian population are in two phylogenetic branches B4 and B1 [20]. Comparing the results obtained from the Najmabadi study and the present study, it was found that branch B1 was the same haplotype group H5 and branch B4 was the same haplotype group H1 [21-23]. Genotyping approaches in this study will significantly reduce research costs by detecting the dominant strain of the population using the simple and inexpensive ARMS-PCR technique instead of the costly whole virus genome sequencing technique. To the best of our knowledge, no such project has been reported in Iran before. ... [24, 25]. These mutations can be interpreted as meaning that the virus can make changes to its genome depending on the conditions in which it is located, to increase its proliferation rate or its binding power by altering the structure of the tentacles to cell surface receptors.
Limitations
Due to temperature sensitivity, the ARMS method requires great care in setting up and obtaining the correct result. To confirm the correct operation of the method, it must be randomly controlled by the sequencing method, which was one of the limitations of this study.
Suggestions
Due to the frequent changes in the virus genome and the possibility of creating new haplotypes with different phenotypic effects, it is suggested that the changes be examined periodically until the complete termination of the disease.
Conclusions
Estimates indicate that the predominant population of viruses infecting Iranians at the beginning of the epidemic had the H5 haplotype. Following the significant expansion of the H1 haplotype group worldwide and over time, this group replaced H5 as the dominant haplotype. H1-type sequences have significant changes in the RdRp and S genes, which are involved in virus replication and binding to the host cell, respectively.
Clinical & Practical Tips in Police Medicine
By identifying the dominant strain of the population in the target range at a much lower cost than complete genomic sequencing, a prelude to other epidemiological studies in the police community was provided.
Acknowledgments
We thank the medical staff of the police hospital, especially the genetic laboratory, the patients studied in the project, and other professors and people who helped us in this project.
Conflict of Interest
The authors state that there is no conflict of interest in the present study.
Funding Sources
The Deputy of Health police headquarter was the financial sponsor of this research.
 
Table 1) List of primers used in this research
Number Primer name sequence primer Tag SNV Haplotype Product Name Piece length
1 H1-14408C>T-out-rv TAGATTACCAGAAGCAGCGTG 14408C>T H1 ARMS-Mutant 216
2 H1-14408C>T-mut.in-fw TTTATTCTCTACAGTGTTCCAACT
3 H1-14408C>T-out-fw TATACGCCAACTTAGGTGAACG 14408C>T H1 ARMS-Normal 470
4 H1-14408C>T-wt.in-rv CACTAGTGGTCCAAAACTTTTAG
5 H2-28144T>C-out-fw CTGTAGCTGCATTTCACCAAG 8782C>T H2 ARMS-Mutant 240
6 H2-28144T>C-mut. in-rv CCTGGCAATTAATTGTAAAAGTTG
7 H2-28144T>C-wt. in-fw GGTAATTATACAGTTTCCTGGTT 8782C>T H2 ARMS-Normal 462
8 H2-28144T>C-out-rv GATCTTTCATTTTACCGTCACCA
9 H5-28688T>C-out-fw ACACCAATAGCAGTCCAGATG 28688T>C H5 ARMS-Mutant 214
10 H5-28688T>C-mut.in-rv ATGTGATCTTTTGGTGTATGCAG
11 H5-28688T>C-out-rv AGTTCCTTGTCTGATTAGTTCCT 28688T>C H5 ARMS-Normal 493
12 H5-28688T>C-wt.in-fw GGTTGCAACTGAGGGAGACT


Table 2) Demographic table of samples received during June-November and frequency of H1 and H5 haplotypes
Date of receiving the sample (month) Number of received samples Number of H5 response samples Number of H1 response samples Number of infected samples with two viruses H5 (Percentage) H1 (Percentage) Percentage of frequency of samples infected with two viruses
June 47 38 9 0 80 20 0
July 49 35 13 1 71 27 2
August 50 26 21 3 52 42 6
September 50 17 31 2 32 62 4
October 47 5 39 3 10 83 7
November 48 1 45 2 2 94 4
Total 291 122 158 11 42 54 4



Figure 1) 28688C> T mutation in H5 haplotype: a) Electrophoresis pattern of PCR products with ARMS-PCR protocol, two models are presented for each sample. A pattern represents the products obtained with the mutants in the no-mutation region and amplifies the 493 base pair fragment (PN). Another represents the products obtained with primers related to the mutated region that amplify the 214 bp fragment (PM). Wells 1 and 2 belong to a normal sample (N) in which only 493 bp fragment was observed. Wells 12-3 correspond to 5 mutant samples (M1-M5) in all of which only 214 bp fragments have been propagated. B) The gel electrophoresis pattern is two heterozygous (MN) samples, both of which were 214 and 493 bp, indicating that the infected person was infected with two different viruses, as well as a normal non-mutant (NN) sample as a control that was only a fragment. 493 base pairs were found. C) Chromatogram of two samples with mutation 28688C> T and one sample heterozygous. The desired mutation point is marked with an arrow



Figure 2) Mutation of 14408C>T Existence in haplotype H1: a) The Electrophoresis pattern of PCR products is with ARMS-PCR protocol that two models are presented for each sample. One pattern represents products produced with primers from the non-mutation region, and the amplifier amplified from it is 470 bp in length (PN). Another represents products obtained with primers from mutant regions that amplify a 216 bp fragment (PM). Wells 1 and 2 belong to a normal sample (N) in which only the amplitude corresponding to the mutation number region with a length of 470 bp is observed. Wells 12-3 belong to 5 mutation specimens (M1-M5), in all of which only 216 bp fragments from the mutant region have been amplified. B) The gel electrophoresis pattern is three heterozygous (MN) samples, both of which are 216 and 470 bp, indicating that the infected person is infected with two different viruses, as well as a non-mutant (NN) sample that is only controlled. 470 based pairs were seen. C) Chromatogram of two samples with mutation 14408C> T and one sample heterozygous. The jump point is marked with an arrow.



Figure 3) Frequency changes of H1 and H5 haplotypes: shows the frequency of two common haplotype groups H5 and H1, in a period of 6 months (June-November). The H5 haplotype was the first group observed in the Iranian patient population, but after a short time, the H1 haplotype was able to become the dominant group. During the period of July (July-November), samples infected with two viruses with different haplotype groups (H1 and H5) were also observed.
Full-Text [PDF 1357 kb]   (2363 Downloads)    
Article Type: Original Research | Subject: Police Health
Received: 2021/12/5 | Accepted: 2022/02/12 | Published: 2022/03/16

References
1. Zhu N, Zhang D, Wang W, Li X, Yang B, Song J, et al. A novel coronavirus from patients with pneumonia in China, 2019. N Engl J Med. 2020;382(8):727-33. https://doi.org/10.1056/NEJMoa2001017 [DOI:10.1056/nejmoa2001017] [PMID] [PMCID]
2. Hu B, Guo H, Zhou P, Shi ZL. Characteristics of SARS-CoV-2 and COVID-19. Nat Rev Microbiol [Internet]. 2021;19(3):141-54. Available from: http://dx.doi.org/10.1038/s41579-020-00459-7 [DOI:10.1038/s41579-020-00459-7] [PMID] [PMCID]
3. Zhou P, Yang X Lou, Wang XG, Hu B, Zhang L, Zhang W, et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature [Internet]. 2020;579(7798):270-3. http://dx.doi.org/10.1038/s41586-020-2012-7 [DOI:10.1038/s41586-020-2012-7] [PMID] [PMCID]
4. Wu F, Zhao S, Yu B, Chen YM, Wang W, Song ZG, et al. A new coronavirus associated with human respiratory disease in China. Nature. 2020;579(7798):265-9. https://www.nature.com/articles/s41586-020-2008-3 [DOI:10.1038/s41586-020-2008-3] [PMID] [PMCID]
5. De Wit E, Van Doremalen N, Falzarano D, Munster VJ. SARS and MERS: Recent insights into emerging coronaviruses. Nat Rev Microbiol. 2016;14(8):523-34. [DOI:10.1038/nrmicro.2016.81] [PMID] [PMCID]
6. Fung TS, Liu DX. Human Coronavirus : Host-Pathogen Interaction. Annu Rev Microbiol. 2019;529-60. [DOI:10.1146/annurev-micro-020518-115759] [PMID]
7. Cui J, Li F, Shi ZL. Origin and evolution of pathogenic coronaviruses. Nat Rev Microbiol. 2019;17(3):181-92. http://dx.doi.org/10.1038/s41579-018-0118-9 [DOI:10.1038/s41579-018-0118-9] [PMID] [PMCID]
8. Guan W, Ni Z, Hu Y, Liang W, Ou C, He J, et al. Clinical Characteristics of Coronavirus Disease 2019 in China. N Engl J Med. 2020;382(18):1708-20. DOI: 10.1056/NEJMoa2002032 [DOI:10.1056/NEJMoa2002032] [PMID] [PMCID]
9. Ramanathan K, Antognini D, Combes A, Paden M, Zakhary B, Ogino M, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395:497-506. [DOI:10.1016/S0140-6736(20)30183-5]
10. Cucinotta D, Vanelli M. WHO declares COVID-19 a pandemic. Acta Biomed. 2020;91(1):157-60. [DOI:10.23750/abm.v91i1.9397]
11. WHO. Addressing Human Rights as Key to the COVID-19 Response. World Heal Organ. 2020:1-4. https://www.who.int/publications-detail/addressing-human-rights-as-key-to-the-covid-19-response
12. Du L, He Y, Zhou Y, Liu S, Zheng BJ, Jiang S. The spike protein of SARS-CoV - A target for vaccine and therapeutic development. Nat Rev Microbiol. 2009;7(3):226-36. https://www.nature.com/articles/nrmicro2090 [DOI:10.1038/nrmicro2090] [PMID] [PMCID]
13. Li F. Structure, Function and evolution of coronavirus spike proteins. Annu Rev Virol. 2016;3:237-61. [DOI:10.1146/annurev-virology-110615-042301] [PMID] [PMCID]
14. Safari I, InanlooRahatloo K, Elahi E. World-wide tracking of major SARS-CoV-2 genome haplotypes in sequences of June 1 to November 15, 2020 and discovery of rapid expansion of a new haplotype. J Med Virol. 2021;93(5):3251-6. [DOI:10.1002/jmv.26802] [PMID]
15. Safari I, InanlooRahatloo K, Elahi E. Evolution of SARS-CoV-2 genome from December 2019 to late March 2020: Emerged haplotypes and informative Tagnucleotide variations. J Med Virol. 2021;93(4):2010-20. [DOI:10.1002/jmv.26553] [PMID] [PMCID]
16. Forster P, Forster L, Renfrew C, Forster M. Phylogenetic network analysis of SARS-CoV-2 genomes. Proc Natl Acad Sci U S A. 2020;117(17):9241-3. [DOI:10.1073/pnas.2004999117] [PMID] [PMCID]
17. Tang X, Wu C, Li X, Song Y, Yao X, Wu X, et al. On the origin and continuing evolution of SARS-CoV-2. Natl Sci Rev. 2020;7(6):1012-23. [DOI:10.1093/nsr/nwaa036] [PMID] [PMCID]
18. Pachetti M, Marini B, Benedetti F, Giudici F, Mauro E, Storici P, et al. Emerging SARS-CoV-2 mutation hot spots include a novel RNA-dependent-RNA polymerase variant. J Transl Med. 2020;18(1):1-9. [DOI:10.1186/s12967-020-02344-6] [PMID] [PMCID]
19. Khailany RA, Safdar M, Ozaslan M. Genomic characterization of a novel SARS-CoV-2. Gene Reports [Internet]. 2020;19:100682. [DOI:10.1016/j.genrep.2020.100682] [PMID] [PMCID]
20. Kames J, Holcomb DD, Kimchi O, DiCuccio M, Hamasaki-Katagiri N, Wang T, et al. Sequence analysis of SARS-CoV-2 genome reveals features important for vaccine design. Sci Rep. 2020;10(1):1-11. [DOI:10.1038/s41598-020-72533-2] [PMID] [PMCID]
21. Djikeng A, Spiro D. Advancing full length genome sequencing for human RNA viral pathogens. Future Virol. 2009;4(1):47-53. https://dx.doi.org/10.2217%2F17460794.4.1.47 [DOI:10.2217/17460794.4.1.47] [PMID] [PMCID]
22. Eden JS, Rockett R, Carter I, Rahman H, De Ligt J, Hadfield J, et al. An emergent clade of SARS-CoV-2 linked to returned travellers from Iran. Virus Evol. 2020;6(1):1-4. [DOI:10.1093/ve/veaa027] [PMID] [PMCID]
23. Fattahi Z, Mohseni M, Jalalvand K, Aghakhani Moghadam F, Ghaziasadi A, Keshavarzi F, et al. SARS-CoV-2 outbreak in Iran: The dynamics of the epidemic and evidence on two independent introductions. Transbound Emerg Dis. 2021:1-12. [DOI:10.1111/tbed.14104] [PMID] [PMCID]
24. Wang R, Chen J, Gao K, Hozumi Y, Yin C, Wei GW. Analysis of SARS-CoV-2 mutations in the United States suggests presence of four substrains and novel variants. Commun Biol. 2021;4(1):1-14. http://dx.doi.org/10.1038/s42003-021-01754-6 [DOI:10.1038/s42003-021-01754-6] [PMID] [PMCID]
25. Jiang Y, Yin W, Xu HE. RNA-dependent RNA polymerase: Structure, mechanism, and drug discovery for COVID-19. Biochem Biophys Res Commun. 2021;538:47-53. [DOI:10.1016/j.bbrc.2020.08.116] [PMID] [PMCID]
26. Zhu N, Zhang D, Wang W, Li X, Yang B, Song J, et al. A novel coronavirus from patients with pneumonia in China, 2019. N Engl J Med. 2020;382(8):727-33. https://doi.org/10.1056/NEJMoa2001017 [DOI:10.1056/nejmoa2001017] [PMID] [PMCID]
27. Hu B, Guo H, Zhou P, Shi ZL. Characteristics of SARS-CoV-2 and COVID-19. Nat Rev Microbiol [Internet]. 2021;19(3):141-54. Available from: http://dx.doi.org/10.1038/s41579-020-00459-7 [DOI:10.1038/s41579-020-00459-7] [PMID] [PMCID]
28. Zhou P, Yang X Lou, Wang XG, Hu B, Zhang L, Zhang W, et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature [Internet]. 2020;579(7798):270-3. http://dx.doi.org/10.1038/s41586-020-2012-7 [DOI:10.1038/s41586-020-2012-7] [PMID] [PMCID]
29. Wu F, Zhao S, Yu B, Chen YM, Wang W, Song ZG, et al. A new coronavirus associated with human respiratory disease in China. Nature. 2020;579(7798):265-9. https://www.nature.com/articles/s41586-020-2008-3 [DOI:10.1038/s41586-020-2008-3] [PMID] [PMCID]
30. De Wit E, Van Doremalen N, Falzarano D, Munster VJ. SARS and MERS: Recent insights into emerging coronaviruses. Nat Rev Microbiol. 2016;14(8):523-34. [DOI:10.1038/nrmicro.2016.81] [PMID] [PMCID]
31. Fung TS, Liu DX. Human Coronavirus : Host-Pathogen Interaction. Annu Rev Microbiol. 2019;529-60. [DOI:10.1146/annurev-micro-020518-115759] [PMID]
32. Cui J, Li F, Shi ZL. Origin and evolution of pathogenic coronaviruses. Nat Rev Microbiol. 2019;17(3):181-92. http://dx.doi.org/10.1038/s41579-018-0118-9 [DOI:10.1038/s41579-018-0118-9] [PMID] [PMCID]
33. Guan W, Ni Z, Hu Y, Liang W, Ou C, He J, et al. Clinical Characteristics of Coronavirus Disease 2019 in China. N Engl J Med. 2020;382(18):1708-20. DOI: 10.1056/NEJMoa2002032 [DOI:10.1056/NEJMoa2002032] [PMID] [PMCID]
34. Ramanathan K, Antognini D, Combes A, Paden M, Zakhary B, Ogino M, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395:497-506. [DOI:10.1016/S0140-6736(20)30183-5]
35. Cucinotta D, Vanelli M. WHO declares COVID-19 a pandemic. Acta Biomed. 2020;91(1):157-60. [DOI:10.23750/abm.v91i1.9397]
36. WHO. Addressing Human Rights as Key to the COVID-19 Response. World Heal Organ. 2020:1-4. https://www.who.int/publications-detail/addressing-human-rights-as-key-to-the-covid-19-response
37. Du L, He Y, Zhou Y, Liu S, Zheng BJ, Jiang S. The spike protein of SARS-CoV - A target for vaccine and therapeutic development. Nat Rev Microbiol. 2009;7(3):226-36. https://www.nature.com/articles/nrmicro2090 [DOI:10.1038/nrmicro2090] [PMID] [PMCID]
38. Li F. Structure, Function and evolution of coronavirus spike proteins. Annu Rev Virol. 2016;3:237-61. [DOI:10.1146/annurev-virology-110615-042301] [PMID] [PMCID]
39. Safari I, InanlooRahatloo K, Elahi E. World-wide tracking of major SARS-CoV-2 genome haplotypes in sequences of June 1 to November 15, 2020 and discovery of rapid expansion of a new haplotype. J Med Virol. 2021;93(5):3251-6. [DOI:10.1002/jmv.26802] [PMID]
40. Safari I, InanlooRahatloo K, Elahi E. Evolution of SARS-CoV-2 genome from December 2019 to late March 2020: Emerged haplotypes and informative Tagnucleotide variations. J Med Virol. 2021;93(4):2010-20. [DOI:10.1002/jmv.26553] [PMID] [PMCID]
41. Forster P, Forster L, Renfrew C, Forster M. Phylogenetic network analysis of SARS-CoV-2 genomes. Proc Natl Acad Sci U S A. 2020;117(17):9241-3. [DOI:10.1073/pnas.2004999117] [PMID] [PMCID]
42. Tang X, Wu C, Li X, Song Y, Yao X, Wu X, et al. On the origin and continuing evolution of SARS-CoV-2. Natl Sci Rev. 2020;7(6):1012-23. [DOI:10.1093/nsr/nwaa036] [PMID] [PMCID]
43. Pachetti M, Marini B, Benedetti F, Giudici F, Mauro E, Storici P, et al. Emerging SARS-CoV-2 mutation hot spots include a novel RNA-dependent-RNA polymerase variant. J Transl Med. 2020;18(1):1-9. [DOI:10.1186/s12967-020-02344-6] [PMID] [PMCID]
44. Khailany RA, Safdar M, Ozaslan M. Genomic characterization of a novel SARS-CoV-2. Gene Reports [Internet]. 2020;19:100682. [DOI:10.1016/j.genrep.2020.100682] [PMID] [PMCID]
45. Kames J, Holcomb DD, Kimchi O, DiCuccio M, Hamasaki-Katagiri N, Wang T, et al. Sequence analysis of SARS-CoV-2 genome reveals features important for vaccine design. Sci Rep. 2020;10(1):1-11. [DOI:10.1038/s41598-020-72533-2] [PMID] [PMCID]
46. Djikeng A, Spiro D. Advancing full length genome sequencing for human RNA viral pathogens. Future Virol. 2009;4(1):47-53. https://dx.doi.org/10.2217%2F17460794.4.1.47 [DOI:10.2217/17460794.4.1.47] [PMID] [PMCID]
47. Eden JS, Rockett R, Carter I, Rahman H, De Ligt J, Hadfield J, et al. An emergent clade of SARS-CoV-2 linked to returned travellers from Iran. Virus Evol. 2020;6(1):1-4. [DOI:10.1093/ve/veaa027] [PMID] [PMCID]
48. Fattahi Z, Mohseni M, Jalalvand K, Aghakhani Moghadam F, Ghaziasadi A, Keshavarzi F, et al. SARS-CoV-2 outbreak in Iran: The dynamics of the epidemic and evidence on two independent introductions. Transbound Emerg Dis. 2021:1-12. [DOI:10.1111/tbed.14104] [PMID] [PMCID]
49. Wang R, Chen J, Gao K, Hozumi Y, Yin C, Wei GW. Analysis of SARS-CoV-2 mutations in the United States suggests presence of four substrains and novel variants. Commun Biol. 2021;4(1):1-14. http://dx.doi.org/10.1038/s42003-021-01754-6 [DOI:10.1038/s42003-021-01754-6] [PMID] [PMCID]
50. Jiang Y, Yin W, Xu HE. RNA-dependent RNA polymerase: Structure, mechanism, and drug discovery for COVID-19. Biochem Biophys Res Commun. 2021;538:47-53. [DOI:10.1016/j.bbrc.2020.08.116] [PMID] [PMCID]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.