logo
Volume 11, Issue 1 (2022)                   J Police Med 2022, 11(1) | Back to browse issues page

Ethics code: IR.IAU.K.REC.1399.020


XML Persian Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Mousavinezhad S A, Harzandi N, Marjani A, Jafari P. The Effectiveness of Chitosan Wound Dressing in the Form of a Film Compared to Its Hydrogel on Burn Wound Healing in the Male Wistar Rat Model. J Police Med 2022; 11 (1) : e31
URL: http://jpmed.ir/article-1-1102-en.html
1- Department of Microbiology, Karaj Branch, Islamic Azad University, Karaj, Iran
2- Department of Microbiology, Karaj Branch, Islamic Azad University, Karaj, Iran , nasharzan@gmail.com
3- Department of Chemistry, Arak Branch, Islamic Azad University, Arak, Iran
4- Department of Microbiology, Faculty of Basic Sciences, Arak Branch, Islamic Azad University, Arak, Iran
English Extended Abstract:   (5096 Views)
Introduction
… [1-5]. Wound healing is a dynamic and complex process, and its purpose is to regenerate the skin as the first barrier to the body's immunity. Ignoring it in military operations and injuries that occur to ordinary people can cause irreparable damage, such as coma and even death [6]. Therefore, researchers are looking for a suitable method for faster wound healing with the least side effects. … [7]. In 1962, as a result of studies and research by Winter et al. [8], it was found that creating a moist surface on the wound significantly affects the healing process. … [9, 10]. Making dressings that, while maintaining the optimal conditions of wounds, do not need to be changed continuously and are easy to use are among the research priorities in designing and manufacturing wound dressings [11]. New wound dressings include foam, film, hydrocolloid, and hydrogel.
AIM(S)
This study aimed to investigate the effectiveness of chitosan wound dressing in the form of a film compared to its commercial form in the form of a hydrogel on burn wound healing in a male Wistar rat model, considering the better structure and effectiveness of each and considering ease of operation and easier portability can be used in police missions.
RESEARCH TYPE
The present study is an experimental intervention study with a control group.
RESEARCH SOCIETY, PLACE & TIME
This study was conducted at the Islamic Azad University of Karaj in Iran in the summer of 2021.
SAMPLING METHOD AND NUMBER
36 male Wistar rats aged four weeks weighing 200-250 grams were purchased from Royan Jahad University Research Institute. The sample volume was calculated based on three daily repetitions and 12 samples in each group. After two weeks of adaptation, the rats were randomly divided into three groups (n=12), including the negative control group (dressing with sterile gas), the control group (dressing with chitoHeal hydrogel), and the test group (dressing with chitosan film).
USED DEVICES & MATERIALS
To carry out this study, the desired chitosan-based dressing was made in the form of a film. To make the intended film, a solution (w/v) of 10% chitosan with an average molecular weight manufactured by Sigma Aldrich Company was prepared in distilled water. It was placed on a heater with a magnetic stirrer for half an hour, and the temperature did not exceed thirty degrees Celsius. 50 ml of distilled water was added to it and the pH of the solution was brought to about four by adding glacial acetic acid. The resulting solution was placed on a heater with a magnetic stirrer for 2 hours at a temperature of 29 degrees and then placed in an ultrasonic bath for half an hour to ensure the complete dissolution of chitosan; then it was poured into a plate and placed at room temperature to dry; after drying, the thickness of the resulting film was measured using a digital micrometer and to check the structure and uniformity of the mixture, the resulting membrane was imaged with the use of SEM electron microscope. The uniformity and thickness of the film can be seen in Figure 1. … [12-17].
METHOD
Rats were anesthetized with the combined anesthetic of ketamine 80 mg/kg and xylazine 10 mg/kg [18], and a burn wound was created by a metal plate heated to about 300 degrees Celsius by a flame without external pressure. Before dressing, the wound was washed with sterile physiological serum. After wound debridement, the rats were treated with appropriate dressing according to the grouping and type of intervention. Before use, the chitosan film was immersed in 0.1 molar solution for 30 seconds; after drying, it was washed with sterile distilled water and fixed on the wound with hypoallergenic glue. Burn treatment and the dressing was done only once on the same zero-day. The transparent healing process was evaluated by measuring the area and percentage of wound healing. For this purpose, after anesthetizing the rats on specific days, the dimensions of the wound were determined using calipers and the percentage of recovery was calculated. On days 3, 7, 14, and 21, three rats from each group were randomly selected, they were killed with ketamine and xylazine anesthesia by cutting the cervical spinal, and the death of the rats was confirmed by taking blood from the heart; after examining the appearance of the wound and measuring the wound surface, a tissue sample was taken from the wound. One part of the tissue was placed in 10% formalin for histological tests, and the second part was kept at -20 degrees Celsius to check gene expression. In order to evaluate histology, samples were painted with hematoxylin and eosin after preparation and cutting; for this purpose, tissue samples were fixed in 10% formalin for 24 hours. First, the sample was dehydrated by placing in increasing percentages of alcohol, and then it was de-alcoholized with the help of different ratios of toluene-ethanol. After the preparation of paraffin blocks, slides of tissue sections with a thickness of 5 μm were prepared and painted with hematoxylin and eosin [19]. To quantify the qualitative variables and compare them, it was done as follows: lack of proliferation of epithelial cells 1, poor epithelial organization 2, incomplete epithelial organization 3, and medium and complete epithelial 4; organization and structure of the collagen matrix: minor zero, thin 1, medium rebuild 2, good and thick collagen 3, completed 4; angiogenesis: absence of zero, presence of congestion, bleeding and edema 1, hemorrhage and two veins in place 2, three to four veins and moderate edema 3, five to six vessels and mild edema 4; degree of inflammation: It was determined based on the number of inflammatory cells. On days 3, 7, 14, and 21, the expression of interleukins 8, 10, and Gapdh genes in skin samples was checked using the Real-time PCR method [20]. For this purpose, RNAs were first isolated from the skin tissue using the RNX-plus kit of Sinaclon Co. Then cDNA was made in this way that ten μl of RNA along with two μl of 5X buffer, 1 µl dNTP, 0.5 microliters of RT enzyme (Reverse Transcriptase), one microliter of primer, According to table 1, and 5.5 microliters of water in the final volume of 20 microliters, at a temperature of 25 degrees Celsius for 3 minutes to connect the primer, the temperature was set at 42°C for 1 hour for cDNA synthesis and 70°C for 5 minutes to inactivate the RT enzyme. In this part, an A100 personal PCR thermocycler was used. A relative quantification method was used to check gene expression with the help of the House-Keeping gene, which was used in this research from Gapdh (Glyceraldehyde-3-phosphate dehydrogenase) gene and with the help of a Real-Time PCR machine. The expression level of genes was normalized with the expression of the Gapdh gene and was determined as (ΔCT= CT Gapdh- Ct target mRNA) ΔCT value. The multiplicity of expression compared to the control group was determined using R=2 -ΔΔCt [21]. The data obtained from Real-Time PCR was in the form of CT number, indicating the number of the cycle in which the multiplication starts exponentially and the graph ascends.
ETHICAL PERMISSION
This study has the ethics ID number IR.IAU.K.REC.1399.020 from the Research Ethics Committee of the Islamic Azad University of Karaj in Iran. All issues related to research ethics and animal rights were observed during the research.
STATISTICAL ANALYSIS
Data analysis was done using IBM SPSS 21 software with the use of the Kruskal Wallis Test and Mann-Whitney statistical tests. Statistical inference criterion p≤0.05 was considered significant.
FINDING by TEXT
Based on the clinical results, the burns of the rats were of the second-degree type. They were not injured due to the burns to the lower organs. After 21 days, wound healing was completed in all groups; in Figure 2, the wound healing process can be seen. Comparing the average percentage of wound healing on the third day between the groups, there was no significant difference between the groups (p value= 0.81), which indicated that the initial wound was the same (Table 2). With the passage of time and on the 7th and 14th days, the percentage of wound healing increased significantly in the two intervention groups compared to the negative control group (p value=0.002), This was despite the fact that no significant difference was observed between the two groups of chitosan film and chitoHeal hydrogel on the seventh day (p value=0.2) and the fourteenth day (p value=0.1). On the 21st day, the wound healing percentage was statistically the same in all groups (p value=0.1).
1- HISTOLOGICAL RESULTS
The degree of epithelialization, angiogenesis, inflammation, and extracellular matrix were used to evaluate histology. The change process of these variables can be seen in Figure 3. In the negative control group on the third day, 66.7% of samples had weak epithelial organization, and 33.3% of samples had incomplete epithelial organization; on the seventh day, 33.3% of the samples of the negative control group had weak epithelial organization, and 66.7% of the samples had incomplete epithelial organization. On the 14th day, 33.3% of the samples had incomplete epithelial organization, 66.7% had medium and complete epithelium, and finally, on the 21st day, 100% had medium and complete epithelium (Table 3). In the hydrogel group, 33.3% had poor epithelial organization on the third day, 33.3% had incomplete epithelial organization, and 33.3% had moderate and complete epithelium. On the seventh day, 66.7% had incomplete epithelial organization, and 33.3% had medium and complete epithelium; on the 14th day, 33.3 had incomplete epithelial organization, and 66.7% of the samples had medium and complete epithelium; and on the 21st day, 100% were in the medium and complete epithelial group (Table 3). In the chitosan film group, on the third day, 33.3% were in the weak epithelial organization group and 66.7% in the incomplete epithelial organization group; on the seventh day, 100% were in an incomplete epithelial organization; on the fourteenth day, 100% of the samples were in the middle and complete epithelial row. By examining the results in the negative control group, 33.3% of the samples on the third day in terms of collagen structure and organization were immature with inflammatory tissue and 66.7% of the samples had a thin and inflammatory collagen structure, in this group on the seventh day, 66.7% of the samples had a thin collagen structure with an inflammatory tissue, 33.3% of the samples had moderate reconstruction in the organization and structure of the collagen matrix. On the 14th day, 100% of the samples were good and thick in terms of collagen, and on the 21st day, all the examined samples had complete organization and collagen structure. In the chitosan film group, in terms of the organization and structure of the collagen matrix, 66.7% of the samples on the third day had a thin and inflammatory collagen structure, and 33.3% had a collagen structure with moderate regeneration; On the seventh day, 33.3% of examined tissues had thin and inflammatory collagen structure, and 66.7% had organization and collagen structure with moderate regeneration. In examining tissues on the 14th day, 66.7% of the samples had good and thick collagen organization, 33.3% of the samples had a completed collagen structure on this day, and of course, 100% of the samples had a completed collagen matrix structure and organization on the 21st day. In the hydrogel group, in terms of the structure and organization of the collagen matrix on the third day, 66.7% of the samples had a structure with moderate regeneration, and 33.3% of the samples had a good and thick collagen structure. On the seventh day, 100% of the samples had a good and thick collagen structure. Moreover, on the 14th day, 33.3% of the samples had a good and thick collagen matrix structure and organization, and the rest were in a completed state. 100% of samples had completed collagen structure and organization on day 21. In diagram 1, you can see the organization and structure of collagen in different groups. Regarding the amount of angiogenesis in the negative control, according to chart 2, 33.3% of the samples on the third day were in the absence of a vessel and 66.7% were in the presence of congestion, bleeding, and edema; On the seventh day, 33.3% of the samples in the category of the presence of congestion, bleeding and edema and 66.7% had a hemorrhage and two veins in the place, on the fourteenth day, 33.3% of the samples in the category of hemorrhage and two veins in the place, 66.7 The percentage of samples had 3 to 4 veins and moderate edema; On the 21st day, 100% were in category 5-6 of weak veins and edema. In the chitoHeal hydrogel group, on the third day, 100% were in the category of congestion, bleeding, and edema, on the seventh day, 33.3% of the samples were in the category of congestion, bleeding, and edema and 66.7% were in the category of hemorrhage and two vessels in place, on the fourteenth day, 33.3% of the samples were in the category of hemorrhage and two veins in the place, and 66.7% of the samples were in the category of 3 to 4 veins and moderate swelling. Moreover, finally, on the 21st day, 100% of the samples in groups 5-6 had weak veins and edema. In the examination of angiogenesis rate in the chitosan film group, 33.3% of the samples on the third day were in the absence category, and 66.7% were in the presence of congestion, bleeding, and edema category; on the seventh day, 33.3% of the samples were in the category of The presence of congestion, bleeding and edema, 66.7% in the category of hemorrhage and two veins in the place, and on the fourteenth day, 33.3% had a hemorrhage and two veins in the place, and 66.7% of the samples had three to four veins and moderate swelling. On the 21st day, 100% of the samples had five to six vessels and weak edema. In examining the results of the equality test of the average inflammation cells on different days in the hydrogel and control groups, there was no significant difference on different days (p value=0.42) and (p value=0.11). However, in the chitosan film group, it can be claimed that chitosan film reduced inflammation (Figure 3).
2- MOLECULAR STUDY of GROUPS
Based on table 4 and chart 4, the level of interleukin eight gene expression was visible compared to the expression in the negative control. Numbers greater than one indicate an increase and less than that indicate a decrease in gene expression. In table 5 and chart 5, the results of interleukin 10 gene expression compared to the negative control can be seen. Numbers greater than one indicate increased expression compared to the negative control. By examining the level of IL-8 gene expression, a significant increase (p value=0.014) of gene expression was evident in the two groups of chitosan in the form of film and hydrogel compared to the negative control on the third day. Meanwhile, this difference was insignificant in the film and hydrogel groups (p value=0.40). On the seventh day, a significant decrease of interleukin eight was observed in both film and hydrogel groups (p value=0.03). Also, in the examination of the film and hydrogel forms on the seventh day (p value=0.10), the fourteenth day (p value=0.1), and the twenty-first day (p value=0.99), no significant difference was observed between the two groups. Based on the results, a significant increase in the expression of the interleukin ten genes was observed in the two groups of chitosan in the form of film and hydrogel compared to the control group on the third day (p value=0.003). In contrast, this difference between the two forms of the film and the hydrogel was not evident. There was no significant difference between the groups on the seventh day (p value=0.09) and the fourteenth day (p value=0.10). However, on the 21st day, a significant increase in the expression of the interleukin ten genes was seen in the chitosan and hydrogel film groups compared to the negative control (p value=0.04); no significant difference was observed between the two forms of film and hydrogel (p.value=0.07).
MAIN COMPARISON to the SIMILAR STUDIES
Thakur reported in 2014 that hydrogel-based polymer dressings facilitate patient wound healing by accelerating and increasing epithelization. Therefore, the number of healed wounds with hydrogel dressings was 85%, and with traditional gauze dressings was 50% [21]. In the histological and molecular examination of inflammatory factors, the favorable effect of chitosan in both forms in controlling inflammation was evident compared to the negative control group; an active wound healing depends on the completion of the inflammatory phase after the injury and if the inflammatory phase is prolonged, it leads to the recurrence of the wound. The increase in the inflammation phase causes an increase in the level of MMPs such as collagenase and gelatinase, which increase MMPs cause damage to the tissue and disruption of the wound healing process. Based on this, the two forms of film and hydrogel do not significantly differ in controlling inflammation from a molecular point of view. However, a sizeable internal variance difference in the film group was seen in some factors, which indicates the different immunological reactions of the animals. However, with the statistical analysis of the number of inflammatory cells, the effect of the form of chitosan film was evaluated as more suitable than hydrogel. Burkatovskaya et al. used dressings impregnated with chitosan for therapeutic effects in wounds infected with Staphylococcus aureus in a mouse model in a 2008 study. In this study, it has been observed that using this dressing for three consecutive days accelerates wound healing compared to the control group; also, the mentioned dressing has reduced inflammation and created significant antimicrobial effects compared to the control group [22], which was consistent with the present study. By examining the degree of epithelialization and the structure and organization of collagen, the favorable effect of chitosan in both film and hydrogel forms was evident; in a way that it can be claimed that the healing time of the burn wound in two chitosan groups is less than the negative control group. In a review study in 2018, Liu et al. investigated the excellent effectiveness of chitosan on wound healing and emphasized its positive effect [23], which was consistent with the results of this study. … [24].
LIMITATIONS
One of the biggest challenges for researchers at the time of conducting the study was the Corona pandemic; at the time of the study, many academic and research centers were closed due to health guidelines.
SUGGESTIONS
The presence of chitosan hydrogel and its film form to treat burns requires additional compounds such as antibiotics and similar compounds for greater effectiveness. It is suggested to make chitosan film with complementary compounds such as silver nanoparticles or probiotics and antibiotics in the form of a composite and check its effectiveness.
CONCLUSIONS
The use of chitosan in the form of film and hydrogel is not different. However, due to the film form's ease of use of the film form and better control of inflammation, and no need for continuous replacement, the chitosan film is better and more efficient in police missions.
CLINICAL & PRACTICAL TIPS in POLICE MEDICINE
New dressings in different forms can reduce the risks associated with possible injuries in the missions of Police personnel.
ACKNOWLEDGMENTS
The researchers of this study thank the laboratory experts of Valiasr Hospital for their cooperation in some stages of the project.
CONFLICT of INTEREST
The authors state that the present study has no conflict of interest.
FUNDING SOURCES
This study was supported by the Islamic Azad University of Karaj in Iran as a part of the Ph.D. thesis.

Table 1) Sequence of primers used in gene expression analysis
Primer Name Sequence 5'→ 3' (10-50 bp)
IL10-F CCTTGTCAGAAATGATCAAG
IL10-R AGAGGGTCTTCAGCTTCTCTC
IL 8-F CGTGGCTCTCTTGGCAGCCTTC
IL 8-R TCCACAACCCTCTGCACCCAGTT
GAPDH-F ATAGAAGGCTGGGGCTCAC
GAPDH-R ATTCACGATGCCAAAGTTG


Table 2) Percentage of burn wound healing
Day Chitoheal gel
Chitosan film Negative control
mean Standard deviation mean Standard deviation mean Standard deviation
3 9 1 10.01 1.01 9.23 0.67
7 60.66 2.51 56.55 3.16 20.55 2.81
14 88.33 2.08 76.66 4.04 50.33 5.85
21 97.66 2.51 96.93 2.72 96.33 3.78


Table 3) The average amount of epithelialization in the samples
Day Chitoheal
chitosan Negative control
mean Standard deviation mean Standard deviation mean Standard deviation
3 3 1 2.66 0.57 2.33 0.57
7 3.33 0.57 3 0.0 2.66 0.57
14 3.66 0.57 4 0.0 3.66 0.57
21 4 0.0 4 0.0 4 0.00


Table 4) Examining the expression of the interleukin 8 genes compared to the negative control
Day Chitoheal
chitosan Negative control
mean Standard deviation mean Standard deviation mean Standard deviation
3 1.3* 0.17 2.03* 1.11 1 0
7 0.61** 0.10 1.74* 0.912 1 0
14 1.09 0.17 2.6* 0.98 1 0
21 1.13 0.41 1.07 0.305 1 0
*significant increase compared to negative control
**significant decrease compared to negative control


Table 5) 10 Interleukin gene expression compared to negative control
Day Chitoheal
chitosan Negative control
mean Standard deviation mean Standard deviation mean Standard deviation
3 3.68* 1.03 2.12* 0.80 1 0
7 0.58 0.24 1.61* 1.20 1 0
14 0.28** 0.25 1.35** 0.40 1 0
21 4.53* 0.83 5.26* 0.88 1 0
*Significant increase compared to the control group
**Significant difference between two groups of chitoheal and Chitosan



Figure 1) SEM electron imaging of chitosan film

 


Figure 2) Images of the wound healing process on days 3, 7, 14, 21




Figure 3) Tissue images on different days with 40 magnification



Chart 1) Structure and organization of collagen



Chart 2) Angiogenesis



Chart 3) Number of inflammatory cells



Chart 4) Interleukin 8 gene expression compared to the control group



Chart 5) 10 Interleukin gene expression compared to negative control
Article number: e31
Keywords: Burn [MeSH], Hydrogel [MeSH], Chitosan [MeSH], Rat [MeSH]
Full-Text [PDF 1345 kb]   (3233 Downloads)    
Article Type: Original Research | Subject: Police Medicine Related Technologies
Received: 2022/05/23 | Accepted: 2022/08/9 | Published: 2022/10/9

References
1. Black JM, Hawks JH. Medical surgical nursing: Clinical management for positive outcomes, 1st edition. Elsevier. India; Mumbai 2009. https://www.elsevier.com/books/medical-surgical-nursing-clinical-management-for-positive-outcomes-8e-2-vol-set-without-cd/black/978-81-312-2982-8
2. Daryabeigi R, Heidari M, Hosseini SA, Omranifar M. Comparison of healing time of the 2 degree burn wounds with two dressing methods of fundermol herbal ointment and 1% silver sulfadiazine cream. Iran J Nurs Midwifery Res. 2010;15(3):97-101. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3093171/#:~:text=The%20mean%20time%20of%20healing,standard%20deviation%20of%202.20%20days.
3. Sabzehchian M. The initial management of acute burns. J Mil Med. 2002;4 (3):203-12. [Persian]. https://www.sid.ir/en/Journal/ViewPaper.aspx?ID=29232
4. Masatoshi J,Hironobu Ihn,Yoshihiro M,Yoshihide A,Kenichi Y,Kunihiko T. Regulation of fibrogenic/fibrolytic genes by plateletderived growth factor C, a novel growth factor, in human dermal fibroblasts. J Cell Physiol. 2005;202(2):510-17. [DOI:10.1002/jcp.20154] [PMID]
5. Barrientos S, Stojadinovic O, S Golinko M, Brem H, Tomic-Canic M, Growth factors and cytokines in wound healing. Wound Repair Regen. 2008;16(5):585-601. https://doi.org/10.1111/j.1524-475X.2008.00410.x [DOI:10.1111/j.1524-475x.2008.00410.x] [PMID]
6. Mahdavi R, Hassani M, Roostaie A, Khalili M, Haghbin Nazar Pa M. Design and manufacture of modified alginate spray as a new wound dressing to control bleeding and wound healing. J P Med. 2021;10(4):225-40. http://jpmed.ir/article-1-1035-en.html
7. Kannon GA, Garrett AB. Moist wound healing with occlusive dressings: a clinical review. Dermatol Surg. 1995;21(7):583-90. [DOI:10.1111/j.1524-4725.1995.tb00511.x] [PMID]
8. Winter GD. Formation of the scab and the rate of epithelization of superficial wounds in the skin of theyoung domestic pig. Nature. 1962;193(4812):293. https://www.nature.com/articles/193293a0 [DOI:10.1038/193293a0] [PMID]
9. Rajendran S. Advanced textiles for wound care. 2 ed. 2019. [DOI:10.1016/C2017-0-00217-3]
10. Ruolan G, Wenzhong S, Hong Z, Zhuona W, Zhiyun M, Xiaoxia Z, Qing T, Ji D, Guifang D. The performance of a fly-larva shell-derived chitosan sponge as an absorbable surgical hemostatic agent. Biomaterials. 2010;31(6):1270-7. [DOI:10.1016/j.biomaterials.2009.10.023] [PMID]
11. Lv FJ, Tuan RS, Cheung KM, Leung VY. Concise review: the surface markers and identity of human mesenchymal stem cells. Stem Cells. 2014;32(6):1408-19. [DOI:10.1002/stem.1681] [PMID]
12. Trott A. Wounds and Lacerations. 4th ed. Saunders. Amazon. 2012:336p. https://www.amazon.com/Wounds-Lacerations-Emergency-Closure-Consult/dp/0323074189 [DOI:10.1016/B978-0-323-07418-6.00002-2]
13. Selvaraj D, Viswanadha VP,Elango S. Wound dressings-a review. J BioMed. 2015;5(4):24-8. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4662938/ [DOI:10.7603/s40681-015-0022-9] [PMID] [PMCID]
14. Olivier G, Killian LH, Nicolas L, Christelle L.G-Ianotto, Mehdi S, et al. TRPV1 and TRPA1 in cutaneous neurogenic and chronic inflammation: pro-inflammatory response induced by their activation and their sensitization. Protein Cell. 2017;8(9):644-61. [DOI:10.1007/s13238-017-0395-5] [PMID] [PMCID]
15. Mizuno K, Yamamura K, Yano K, Osada T, Saeki S, Takimoto N, Sakurai T, Nimura Y. Effect of chitosan film containing basic fibroblast growth factor on wound healing in genetically diabetic mice. J Biomed Mater Res A. 2003;64(1):177-81. [DOI:10.1002/jbm.a.10396] [PMID]
16. Yixiao D, Meihua C, Ju Q, Xuechun W, Sun H.K, Barrera J et al. Conformable hyaluronic acid hydrogel delivers adipose-derived stem cells and promotes regeneration of burn injury. Acta Biomaterialia J, 2020:108:56-66. [DOI:10.1016/j.actbio.2020.03.040] [PMID]
17. Nasiry D, Khalatbary AR, Abdollahifar M-A, Amini A, Bayat M, Noori A, et al. Engraftment of bioengineered three- dimensional scaffold from human amniotic membrane-derived extracellular matrix accelerates ischemic diabetic wound healing. Arch Dermatol Res 2020;313(7):567-82. [DOI:10.1007/s00403-020-02137-3] [PMID]
18. Afzali F. Mirahmadi-Babaheydari F. Shojaei-Ghahrizjani S. Rahmati, B. Shahmoradi, M. Banitalebi-Dehkordi The effect of encapsulated umbilical cord-derived mesenchymal stem cells in PRPCryogel on regeneration of grade-II burn wounds. Regen Eng Transl Med. 2020:1-11. http://eprints.skums.ac.ir/8795/ [DOI:10.1007/s40883-020-00188-6]
19. Fischer A.H, Jacobson K.A, Rose J, Zeller R. Hematoxylin and eosin staining of tissue and cell sections. CSH Protoc.2008. [DOI:10.1101/pdb.prot4986] [PMID]
20. Taherzadeh-Soureshjani P, Chehelgerdi.Algae M. Algae-meditated route to cuprous oxide (Cu2O) nanoparticle: differential expression profile of MALAT1 and GAS5 LncRNAs and cytotoxic effect in human breast cancer. Cancer Nanotechnol.2020;11(1):1-34. https://cancer-nano.biomedcentral.com/articles/10.1186/s12645-020-00066-4 [DOI:10.1186/s12645-020-00066-4]
21. EsmaeelSharifiMohammadChehelgerdi, AliFatahian-Kelishadrokhi, FarshadYazdani-Nafchi, KoroshAshrafi-Dehkord. Comparison of therapeutic effects of encapsulated Mesenchymal stem cells in Aloe vera gel and Chitosan-based gel in healing of grade-II burn injuries. Regen Ther. 2021;18:30-7. [DOI:10.1016/j.reth.2021.02.007] [PMID] [PMCID]
22. Thakur S, Govender PP, Mamo MA, Tamulevicius S, Thakur VK. Recent progress in gelatin hydrogel nanocomposites for water purification and beyond. Vacuum 2017;146: 396-408. [DOI:10.1016/j.vacuum.2017.05.032]
23. Marina Burkatovskaya, Ana P. Castano,Tatiana N. Demidova-Rice, George P. Tegos,, and Michael R. Hamblin. Effect of chitosan acetate bandage on wound healing in infected and noninfected wounds in mice. Wound Repair Regen. 2008;16(3):425-31. [DOI:10.1111/j.1524-475X.2008.00382.x] [PMID] [PMCID]
24. He Liu, Chenyu Wang, Chen Li, Yanguo Qin, Zhonghan Wang, Fan Yang, Zuhao Li and Jincheng Wang. A functional chitosan-based hydrogel as a wound dressing and drug delivery system in the treatment of wound healing. Royal Soc Chem J. 2018;8:7533-49. https://pubs.rsc.org/en/content/articlelanding/2018/ra/c7ra13510f [DOI:10.1039/C7RA13510F] [PMID] [PMCID]

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.